Absstract of: US20260174904A1
0000 A B-cell specific octamer-binding protein 1 super-enhancer ribonucleic acid (BOB1-seRNA) and an application thereof are provided. The nucleotide sequence of the BOB1-seRNA is shown in SEQ ID NO: 1. Through experiments, it further confirms that the BOB1-seRNA is downregulated in patients with coronary heart disease and can be used in preparation of a product for diagnosing or predicting the coronary heart disease. The use of this molecular marker can be used for early diagnosis of the coronary heart disease, which is rapid and effective. It is not only of great significance for early treatment of the coronary heart disease and saving medical costs, but also provides therapeutic targets and important basis for clinical applications such as gene therapy and drug therapy.
Absstract of: CN122256497A
The invention discloses application of an intestinal bacterium metabolism key gene in preparation of an atherosclerosis diagnosis product, and belongs to the technical field of biological medicines. The invention establishes a CRISPR/Cas12a detection method based on RPA and crRNA array mediation, can accurately detect eight intestinal bacteria metabolism key genes closely related to cardiovascular diseases, and realizes rapid diagnosis according to the detection result. The invention provides a new technical means for evaluating the risk of cardiovascular diseases, and has potential application value in the aspects of early screening, prediction and judgment of diseases.
Absstract of: KR20240114848A
The present invention relates to a marker composition, a kit, a panel, and a method for providing information for diagnosing, generating, or predicting prognosis of stroke. The present invention is a novel tool capable of predicting the diagnosis, occurrence, progress, or prognosis of a stroke. the present invention has excellent sensitivity and can be easily analyzed without using a biopsy, thereby being usefully used for early diagnosis, occurrence, or prognosis prediction of a stroke.
Absstract of: CN122235297A
The invention discloses application of PRMT9 or an encoded protein thereof as a pulmonary arterial hypertension diagnosis and treatment target, and belongs to the technical field of biological medicines. The invention discloses an application of detecting the expression level of a PRMT9 gene or the content of an encoded protein of the PRMT9 gene in screening a product for diagnosing pulmonary arterial hypertension, and further discloses an application of a PRMT9 gene knocked-down mouse model in screening a medicine for preventing, relieving and/or treating pulmonary arterial hypertension. The invention is applied to research on PRMT9 gene expression or PRMT9 gene product activity, pathology improvement and behavioral change improvement. The invention finds that the expression of the PRMT9 in the pulmonary arterial hypertension is obviously increased, the pulmonary arterial hypertension can be improved by inhibiting the PRMT9 gene, a new idea for diagnosing the pulmonary arterial hypertension by taking the PRMT9 gene and the encoded protein thereof as targets is provided, a product and various biological models for diagnosing the pulmonary arterial hypertension are also provided, and the application has good practical prospects and research potential.
Absstract of: CN122235152A
The invention belongs to the technical field of biological medicine, and particularly relates to application of Popdc1 frameshift mutation in treatment and detection of dilated heart disease. According to the invention, a candidate pathogenic gene Popdc1 gene is screened, the frame shift mutation (c.448delT) of the candidate pathogenic gene Popdc1 gene causes early termination of the synthesis of encoded BVES protein, and cardiomyopathy and cardiomyopathy are caused by the modes of regulating downstream genes, oxidative stress, cell apoptosis and the like through a BVES-AnkG-CaMKII pathway. By detecting the homozygous frame-shift mutation (c.448delT) of the Popdc1 gene, early warning is made for early diagnosis and prenatal breeding of the dilated heart disease; through the gene therapy of targeting BVES, AnkG and CaMKII, the treatment of the hereditary dilated heart disease can be realized; the animal model is constructed by using the mutation site, a model basis is provided for research of cardiomyopathy, and the application prospect is wide.
Absstract of: CN122235289A
The invention relates to the technical field of biological medicine, provides novel application of PRMT5, and particularly relates to application of PRMT5 in preparation of a pulmonary arterial hypertension diagnosis and treatment product. The invention further provides a PRMT5 inhibitor recombinant vector and a pulmonary arterial hypertension treatment pharmaceutical composition taking the PRMT5 inhibitor or a recombinant expression vector thereof as an active component. It is found for the first time that expression of PRMT5 in lung tissues of patients and models with pulmonary arterial hypertension is increased, pathological injuries, including pulmonary vascular remodeling and right ventricular hypertrophy, of pulmonary arterial hypertension can be remarkably relieved by intervening expression quantity and/or biological activity of PRMT5 through gene level (Lenti-shPRMT5) or drug level (EPZ015666), and it is prompted that PRMT5 has a key effect in generation and development of PAH. The discovery provides an experimental basis for the research and development of PRMT5 as a potential therapeutic target and related drugs thereof.
Absstract of: CN122235296A
The invention belongs to the technical field of biomarkers, and particularly relates to application of DEFA1 as an acute ischemic stroke prognosis biomarker. It is found that the DEFA1 gene has significant differential expression between acute ischemic stroke patients with vascular events and acute ischemic stroke patients without vascular events or death within one year, and the expression level of the DEFA1 gene in the patients with vascular events or death is significantly higher than that of the patients without vascular events or death; the DEFA1 gene has significant differential expression between acute ischemic stroke patients with severe disability or death and acute ischemic stroke patients without severe disability or death within 3 months, and the expression level of the DEFA1 gene in the patients with severe disability or death is significantly higher than that of the patients without severe disability or death. The DEFA1 shows good predictive ability in predicting whether a patient suffering from cerebral arterial thrombosis suffers from poor prognosis within 1 year and/or 3 months.
Absstract of: CN122249562A
The present application provides methods of treating conditions associated with senescence, atrophy, fibrosis, tissue senescence, inflammation, heart disease, and/or muscle disease by administering to a subject an agent that enhances the expression of a Trex1 gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). The present application also provides compositions for treating conditions associated with aging, atrophy, inflammation, and/or fibrosis, including a nucleic acid that will anneal with and enhance the expression of Trex1 5 '-UTR, a nucleic acid that encodes and enhances the expression of Trex1, a population of macrophages having enhanced expression of a Trex1 gene product, or a combination thereof.
Absstract of: AU2024406171A1
This disclosure relates generally to methods of screening and preparing cardiac cell therapies having low risk of causing graft-induced arrhythmias.
Absstract of: KR20260092168A
본 발명은 SOCS3를 유효성분으로 포함하는 혈관 석회화 진단, 예방 및 치료용 조성물에 관한 것으로서, 본 발명의 SOCS3는 혈관이 석회화된 경우 발현이 감소하며, SOCS3가 과발현되는 경우 그 석회화가 현저히 감소되므로, SOCS3를 이용하면 평활근 세포 등의 관련 혈관 석회화 질환에서 혈관 석회화의 예방 또는 치료에 유용하게 이용될 수 있다.
Absstract of: WO2026127584A1
The present invention relates to a biomarker for diagnosing or predicting the onset of postoperative acute kidney injury, and a method for diagnosing or predicting the onset of postoperative acute kidney injury using same. Specifically, the present invention relates to a method for diagnosing or predicting the onset of acute kidney injury by using, as a biomarker, miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, or miR-548aq-3p in a blood sample following open-heart surgery.
Absstract of: CN122214339A
The invention belongs to the field of life science and biological medicine, and relates to novel micro ribonucleic acid (microRNA, miRNA) as well as a screening method and application thereof. The novel miRNA is named as novel miR-25 and is positioned in an intron region of long-chain non-coding RNA HERC2P2 of a positive-sense strand of a human chromosome 15, and the invention discloses a mature body and a precursor sequence of the novel miRNA. The invention further provides a method for screening the microRNA, which comprises the following steps: carrying out small RNA-seq (small RNA-seq) on THP-1-derived foam cells, combining sequence alignment and new miRNA prediction software analysis to obtain candidate molecules, and carrying out expression verification to obtain the novomiR-25. The miRNA plays a key role in regulating macrophage lipid homeostasis and intervening foam cell formation, overexpression can promote accumulation of total cholesterol and cholesteryl ester, and expression inhibition can relieve lipid accumulation. In a high-fat feed induced ApoE <-/-> atherosclerosis mouse model, the antagonist shows excellent effects of lowering lipid and reducing plaque expansion, and can also be used for preparing drugs for related metabolic diseases.
Absstract of: CN122214485A
The invention discloses application of liver cell factor kininogen (KNG1) as a target spot in preparation of a product for detecting MASLD, and belongs to the technical field of biological medicine. It is found for the first time that expression of KNG1 serving as liver secretory protein in livers and plasma of MASLD patients and MASLD model mice is remarkably reduced, and the expression level of KNG1 is in negative correlation with the liver fat accumulation degree and the blood pressure level; meanwhile, the degradation product bradykinin BK of the KNG1 can regulate and control the vasodilation function to maintain the stable blood pressure, and the down-regulation of the KNG1 in the MASLD state can lead to the blockage of vasodilation and further lead to hypertension. Furthermore, the invention provides a medicine capable of up-regulating KNG1 gene expression or enhancing KNG1 protein activity, synchronous intervention on MASLD core pathological links and hypertension complications is realized, the technical defect that the MASLD core pathological links and the hypertension complications cannot be considered by the existing treatment means is overcome, and the medicine has a wide clinical application prospect.
Absstract of: CN122218247A
The invention provides a myocardial infarction diagnosis marker and a myocardial infarction treatment drug, and belongs to the technical field of in-vitro diagnosis and biological medicine crossing, specifically, the myocardial infarction diagnosis marker provided by the invention comprises FGF18 protein or a protein mutant with at least 90% sequence identity with the FGF18 protein, and the amino acid sequence of the FGF18 protein is as shown in SEQ ID No.1. The myocardial infarction treatment medicine provided by the invention comprises an FGF18 protein or an FGF18 protein expression promoter. The FGF18 is provided as the myocardial infarction diagnosis marker and the myocardial infarction treatment medicine for the first time, and a new thought is provided for detection and treatment of myocardial infarction.
Absstract of: CN122188929A
The invention discloses an application of a transcription factor MEF2D in regulating expression of a myocardial cell BIN1 and maturation of a T tube. A method of modulating the expression of BIN1 in myocardial cells for non-diagnostic and therapeutic purposes, said method modulating the expression of BIN1 by altering the binding of myocardial cells MEF2D to a BIN1 promoter. A binding inhibitor of MEF2D and a BIN1 promoter can promote T tube maturation and improve RVPO right ventricular function.
Absstract of: CN122182776A
The invention provides application of an SNAI1 inhibitor in preparation of a medicine for treating intervertebral disc degeneration diseases, and belongs to the technical field of biological medicine manufacturing. The invention discloses application of SNAI1 as a target spot in screening, developing and preparing medicines for preventing and/or treating intervertebral disc degeneration diseases or complications of the intervertebral disc degeneration diseases. The invention discloses that the transcriptional activity of SNAI1 is physically isolated and inhibited by a YAP (Yttrium Activated Protein) aggregate, and when YAP is reduced due to mechanical stress, the SNAI1 is released and activated, so that the expression of angiogenic factors ANGPTL4 and VEGFA (Vascular Endothelial Growth Factor A) is directly transcribed and up-regulated, and intervertebral disc vascularization and degeneration are synergistically driven. The SNAI1 inhibitor (such as CYD-19) can inhibit the transcriptional activity of SNAI1 in a targeted manner and inhibit nucleus pulposus cells from generating pro-angiogenesis factors, so that the compound can be used for treating or preventing intervertebral disc vascularization, degeneration and related pains.
Absstract of: WO2026120283A1
Provided herein are methods treating and assessing acute ST-Elevation Myocardial Infarction (STEMI) in a subject. Also provided herein are methods of treating a patient based on predicting the risk associated with acute ST-Elevation Myocardial Infarctions.
Absstract of: US20260159578A1
0000 Methods provide a tractable roadmap for drug-target prioritization within the druggable genome by triangulating evidence from population genomic, transcriptomic and proteomic data. Multiple lines of evidence suggest certain drug targets to have a causative role in WMH burden and AD risk. This goes beyond biomarker functions, emphasizing drug-repurposing opportunities and supporting rationale for clinical trials. Additionally, the shared gene function among prioritized targets underscores the importance of post-translational modification in the AD disease process. Lastly, from a genetic epidemiology standpoint, our study provides novel insights into the connection between vascular brain injury, the coagulation cascade, and AD risk, including the possibility of specific coagulation components with potential causal roles.
Absstract of: CN122168748A
The invention discloses a reagent for detecting long fragment deletion mutation of an FHOD3 gene and application of the reagent, and belongs to the technical field of biological medicines. The reagent comprises a nucleic acid molecule for specifically recognizing deletion mutation of a long fragment in an intron starting region of the FHOD3 gene, and particularly a primer and a probe aiming at deletion mutation of No.12-No.14 exons and/or deletion mutation of No.15 exons. The invention discovers and verifies the two pathogenic deletion mutations closely related to hypertrophic cardiomyopathy for the first time. By matching with a micro-droplet digital PCR technology, the sensitivity of the reagent reaches 99%, the specificity reaches 95% or above, the repeatability is good, and the accuracy reaches 95%-99%. The new detection rate in the patient family with negative whole exome sequencing in the past reaches 40%, the defect that the long fragment deletion of the intron starting region cannot be detected in the prior art is effectively overcome, and the method is suitable for gene diagnosis, family genetic screening and genetic counseling of hypertrophic cardiomyopathy.
Absstract of: CN122168747A
The invention belongs to the technical field of biology, and discloses a group of biomarkers for risk prediction of idiopathic pulmonary hypertension and application of the biomarkers. According to the method, expression quantitative trait locus (eQTL) data from peripheral blood and lung tissue, a single-cell RNA sequencing (scRNA-seq) data set and whole genome association analysis (GWAS) summarized statistical data of idiopathic pulmonary hypertension are integrated, and a Mendel randomization algorithm (MR), genome enrichment analysis and immunofluorescence experiments are used for identifying and accurately positioning related genes; biomarkers related to the risk of idiopathic pulmonary hypertension, including at least one of CST7, HLA-B, HLA-E, FKBP1A, and UBB, have been found for the first time. By detecting the biomarker, the risk condition of idiopathic pulmonary hypertension can be effectively diagnosed.
Absstract of: CN122168744A
The invention relates to the technical field of biological medicines, in particular to application of Enoph1 in treatment and/or diagnosis of cardiomyopathy or heart failure. The application finds that the expression level of Enoph1 in patients with cardiomyopathy or heart failure is remarkably up-regulated. Furthermore, overexpression of Enoph1 in myocardial cells finds that overexpression of Enoph1 can recover the number of myocardial cells, glycolysis of myocardial cells, oxygen breathing function and mitochondrial function, reduce generation of active oxygen, protect myocardial cells and achieve the effect of treating cardiomyopathy or heart failure.
Absstract of: CN122171695A
The invention provides an application of valeryl carnitine in preventing and treating the progress of a salt-sensitive hypertension state. The invention provides application of acyl carnitine, especially valeryl carnitine, in a sample from an individual as a target spot in screening and/or preparing a reagent and/or a medicine for preventing and treating salt-sensitive hypertension. The invention also provides application of the acyl carnitine or a reagent for detecting the acyl carnitine in a sample from an individual in preparation of a product for evaluating the progress of the blood pressure state of the individual, and application of the acyl carnitine in preparation of a product for improving, preventing and/or treating salt-sensitive hypertension. The acylcarnitine is found to be remarkably related to hypertension attack and blood pressure state progress, and is expected to become a potential dietary supplement or intervention target for preventing and treating hypertension.
Absstract of: CN122180498A
The present invention relates to a cosmetic composition, advantageously an eco-biological cosmetic composition, comprising:-polyglutamic acid or a salt thereof; and-at least one peptide derivative represented by general formula (I) wherein:-R1 represents a hydrogen atom, an acyl radical or an acyloxy radical; and-R2 represents a side chain of an alpha-amino acid selected from the group consisting of tryptophan, glutamic acid, arginine, cysteine, methionine, histidine and tyrosine. The invention also relates to the use of said cosmetic composition for combating skin redness and/or skin aging; to the use thereof for preventing and/or combating hyperplasia of skin blood vessels and/or skin inflammation and/or rosacea; and to methods for selecting compounds suitable for preventing and/or combating these conditions.
Absstract of: US20260151373A1
0000 The current methods and compositions relate to treatment of atrial fibrillation with bucindolol in patients, including patients with heart failure, after being determined to be homozygous Arg389 in the β<1 >adrenergic receptor gene.
Nº publicación: CN122124244A 02/06/2026
Applicant:
CHINESE PLA GENERAL HOSPITAL
\u4E2D\u56FD\u4EBA\u6C11\u89E3\u653E\u519B\u603B\u533B\u9662
Absstract of: CN122124244A
The invention relates to the technical field of biological medicines, in particular to application of PTPRM in treatment and/or prevention of sepsis cardiomyopathy. The application discovers that the expression level of PTPRM in heart tissue of a CLP model is remarkably reduced, and further verifies that the survival rate of the CLP model is remarkably improved after PTPRM overexpression, PAT reduction and RVFW, RVSFW, LVSFW, LVDFW, IVS-s and IVS-d increase caused by CLP modeling are also improved, in addition, the expression level of cardiac troponin (cTNT) and right ventricular wall thickness can also be reduced by overexpression of PTPRM, and the survival rate of the CLP model is remarkably improved. PTPRM can be used as a target spot for treating sepsis cardiomyopathy.