Resumen de: WO2026156121A1
The present disclosure relates generally to the treatment of subjects having a lipid disorder or a cardiovascular disease or at risk of developing a lipid disorder or a cardiovascular disease by administering a Phospholipase A2 Group XIIB (PLA2G12B) inhibitor to the subject.
Resumen de: US20260209290A1
Disclosed is a method, a pharmaceutical composition, and a pharmaceutical preparation for prevention and/or treatment of pulmonary arterial hypertension (PAH). The method includes administering to a subject at least one of a first agent that inhibits binding of Hic-5 to SMAD7 or a second agent that inhibits Hic-5.
Resumen de: US20260210975A1
0000 A method of determining a risk of developing a neurological disorder in a Long-COVID patient comprising: (a) testing levels of at least one marker associated with a neurologic disorder in a sample taken from the Long-COVID patient, and (b) making a determination that the Long-COVID patient is at risk of developing said neurological disorder when the levels of said at least one marker is increased in the Long-COVID patient compared to healthy control reference levels of said marker. Also a method of determining a risk of developing a cardiometabolic injury in a Long-COVID patient when the levels of expression of a marker associated to a cardiometabolic injury is different in the Long-COVID patient than the levels of said marker in a healthy control. Also methods of treating Long-COVID with a drug effective to mediate the HIF signaling pathway.
Resumen de: US20260207775A1
The invention relates to the field of diseases caused by high levels of LDL-C and/or fibrinogen, such as cardiovascular disease. The invention involves oligonucleotides for RNA editing technology in deaminating target adenosine nucleotides, such as the adenosine at position 1055, in transcripts of the human B4GALT1 gene.
Resumen de: WO2025059367A1
Provided herein are methods of treating a condition associated with aging, atrophy, fibrosis, tissue senescence, inflammation, a heart condition, and/or a muscle disorder by administering to a subject an agent that enhances expression of a Trex1 gene product, where the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:3). Also provided herein are compositions for treating a condition associated with aging, atrophy, inflammation and/or fibrosis comprising a nucleic acid that anneals to the Trex1 5' UTR and enhances Trex1 expression, a nucleic acid encoding Trex1 that enhances Trex1 expression, a population of macrophages having enhanced expression of the Trex1 gene product or a combination thereof.
Resumen de: US20260201474A1
0000 The present disclosure relates generally to methods for accurately predicting the risk of cancer-associated venous thromboembolism (CAT) and/or preventing CAT in cancer patients using ctDNA as a biomarker.
Resumen de: US20260201372A1
0000 Compositions and methods are disclosed for treating metabolic syndrome-associated heart disease cardiomyopathy and/or heart failure, wherein the method comprises the step of increasing the concentration of LIPTER RNA in the cardiomyocytes of said patient.
Resumen de: WO2026152007A1
Disclosed are methods for assessing the likelihood of a subject developing coronary artery disease (CAD). The methods comprise determining a polygenic risk score based on a set of single nucleotide polymorphisms associated with endothelial cell function. The assessment may include the subject's LDL-C levels as a factor, and the methods include determining a subject's sensitivity to LDL-C mediated CAD. Determination of increased risk for CAD is followed by treatment with an anti-CAD therapy.
Resumen de: WO2026149323A1
Provided are the methods of use and pharmaceutical compositions of mitochondrial uncouplers and glucagon-like peptide-1 receptor agonists for treating various diseases and conditions, including obesity, T2DM, liver diseases and conditions (e.g., MASH), and cardiovascular diseases and conditions(e.g.,heart failure).
Resumen de: WO2026148565A1
The use of annexin A2 (ANXA2) and an inhibitor thereof in the diagnosis, treatment and/or prevention of pulmonary hypertension. Specifically disclosed is the use of an ANXA2 inhibitor (comprising an siRNA for silencing the ANXA2 gene, an ANXA2 antibody, and a phosphorylation inhibitor) in the preparation of a product for preventing and/or treating pulmonary hypertension. It is verified in experiments that the ANXA2 inhibitor can significantly inhibit the proliferation and migration of pulmonary arterial smooth muscle cells, and significantly ameliorate pulmonary hypertension, pulmonary arterial vascular remodeling, and right ventricular hypertrophy. The ANXA2 or ANXA2 protein Thr208 phosphorylation site can be used in the diagnosis or assisted diagnosis of pulmonary hypertension, or in the screening of drugs for pulmonary hypertension and the development of new diagnostic and therapeutic methods and drugs. The developed therapeutic target and ANXA2 inhibitor have a high clinical application value in the fields of diagnosis, prevention, and treatment of pulmonary hypertension.
Resumen de: US20260191897A1
0000 The present disclosure provides methods of treating a subject having metabolic disorders and/or cardiovascular diseases, methods of identifying subjects having an increased risk of developing a metabolic disorder and/or a cardiovascular disease, and methods of detecting human Inhibin Subunit Beta E variant nucleic acid molecules and variant polypeptides.
Resumen de: US20260193711A1
0000 Method of prediction of pregnancy complications associated with a high risk of pregnancy loss, such as miscarriage, stillbirth, or HELLP syndrome. Pregnant women are screened to determine the expression profile of two or more miRNAs in whole peripheral venous blood collected in the period of 10th-13th gestational week, whereas said two or more miRNAs are selected from the group miR-1-3p, miR-16-5p, miR-17-5p, miR-20a-5p, miR-26a-5p, miR-130b-3p, miR-143-3p, miR-145-5p, miR-146a-5p, miR-181a-5p, miR-195-5p, miR-210-3p, miR-342-3p, miR-499a-5p a miR-574-3p.
Resumen de: WO2025046293A1
A method of assessing expression profiles of miRNA markers using predictive classification models to differentially diagnosing MMVD patients from healthy controls or DCM patients from healthy controls. Additionally, an assessment of the same method to discriminate pre-clinical from clinical MMVD or DCM patients. Also provided is a method of differentially diagnosing MMVD patients from DCM patients or from healthy controls.
Resumen de: US20260176700A1
0000 The invention relates to an assay. More specifically, the invention relates to an assay for predicting cardiovascular toxicity of a chemotherapeutic agent.
Resumen de: US20260174904A1
0000 A B-cell specific octamer-binding protein 1 super-enhancer ribonucleic acid (BOB1-seRNA) and an application thereof are provided. The nucleotide sequence of the BOB1-seRNA is shown in SEQ ID NO: 1. Through experiments, it further confirms that the BOB1-seRNA is downregulated in patients with coronary heart disease and can be used in preparation of a product for diagnosing or predicting the coronary heart disease. The use of this molecular marker can be used for early diagnosis of the coronary heart disease, which is rapid and effective. It is not only of great significance for early treatment of the coronary heart disease and saving medical costs, but also provides therapeutic targets and important basis for clinical applications such as gene therapy and drug therapy.
Resumen de: KR20240114848A
The present invention relates to a marker composition, a kit, a panel, and a method for providing information for diagnosing, generating, or predicting prognosis of stroke. The present invention is a novel tool capable of predicting the diagnosis, occurrence, progress, or prognosis of a stroke. the present invention has excellent sensitivity and can be easily analyzed without using a biopsy, thereby being usefully used for early diagnosis, occurrence, or prognosis prediction of a stroke.
Resumen de: AU2024406171A1
This disclosure relates generally to methods of screening and preparing cardiac cell therapies having low risk of causing graft-induced arrhythmias.
Resumen de: KR20260092168A
본 발명은 SOCS3를 유효성분으로 포함하는 혈관 석회화 진단, 예방 및 치료용 조성물에 관한 것으로서, 본 발명의 SOCS3는 혈관이 석회화된 경우 발현이 감소하며, SOCS3가 과발현되는 경우 그 석회화가 현저히 감소되므로, SOCS3를 이용하면 평활근 세포 등의 관련 혈관 석회화 질환에서 혈관 석회화의 예방 또는 치료에 유용하게 이용될 수 있다.
Resumen de: WO2026127584A1
The present invention relates to a biomarker for diagnosing or predicting the onset of postoperative acute kidney injury, and a method for diagnosing or predicting the onset of postoperative acute kidney injury using same. Specifically, the present invention relates to a method for diagnosing or predicting the onset of acute kidney injury by using, as a biomarker, miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, or miR-548aq-3p in a blood sample following open-heart surgery.
Resumen de: US20260159578A1
0000 Methods provide a tractable roadmap for drug-target prioritization within the druggable genome by triangulating evidence from population genomic, transcriptomic and proteomic data. Multiple lines of evidence suggest certain drug targets to have a causative role in WMH burden and AD risk. This goes beyond biomarker functions, emphasizing drug-repurposing opportunities and supporting rationale for clinical trials. Additionally, the shared gene function among prioritized targets underscores the importance of post-translational modification in the AD disease process. Lastly, from a genetic epidemiology standpoint, our study provides novel insights into the connection between vascular brain injury, the coagulation cascade, and AD risk, including the possibility of specific coagulation components with potential causal roles.
Resumen de: WO2026120283A1
Provided herein are methods treating and assessing acute ST-Elevation Myocardial Infarction (STEMI) in a subject. Also provided herein are methods of treating a patient based on predicting the risk associated with acute ST-Elevation Myocardial Infarctions.
Resumen de: US20260151373A1
0000 The current methods and compositions relate to treatment of atrial fibrillation with bucindolol in patients, including patients with heart failure, after being determined to be homozygous Arg389 in the β<1 >adrenergic receptor gene.
Resumen de: CN122104891A
The invention provides a single or combined gene marker of GFPT2, LUM, TNXB and THBS4 and application of the gene marker in risk early warning and prognosis evaluation of cardiovascular diseases, and belongs to the technical field of biomedicine. The invention provides a universal molecular marker composition which is closely associated with a common core pathological mechanism (namely myocardial fibrosis) finally causing heart failure, and the universal molecular marker composition can cross the initial causes of different cardiovascular diseases and can be used for detecting the heart failure in the early stage of irreversible fibrosis damage of myocardium. Accurate early warning and prognosis evaluation of the heart failure risk are realized, and a time window and a targeting basis are provided for early intervention. The invention finds that the four genes GFPT2, LUM, TNXB and THBS4 can be independently used or a combination of the four genes can be used as a universal biomarker for crossing different causes and specifically pre-warning a common end pathway (myocardial fibrosis) of heart failure. The invention establishes a heart failure risk prediction mathematical model which is based on the expression levels of the four genes and is suitable for wide cardiovascular patient groups.
Resumen de: US20260148848A1
0000 The disclosure relates to a combination of biomarkers comprising at least: (i-a) one biomarker selected in each of the following group of biomarkers: Patient's age, Plasma steroids, and Urinary steroids, and at least one biomarker selected in at least one of the group of biomarkers: O-methylated catecholamines, Small metabolites, and miRNA; or (i-b) one biomarker selected in each of the following group of biomarkers: Plasma steroids, Urinary steroids, and Small metabolites, and at least one biomarker selected in at least one of the group of biomarkers: Patient's age, O-methylated catecholamines, and miRNA. The combinations of biomarkers may be used for stratifying a hypertensive patient among different hypertensive diseases comprising Endocrine Hypertension (EHT), Primary Aldosteronism (PA), Pheochromocytoma/Functional Paraganglioma (PPGL), Cushing's Syndrome (CS), and Primary Hypertension (PHT).
Nº publicación: EP4748932A1 27/05/2026
Solicitante:
FUNDACION INSTITUTO DE INVESTIG SANITARIA FUNDACION JIMENEZ DIAZ [ES]
Fundacion Instituto De Investigacion Sanitaria Fundacion Jimenez Diaz
Resumen de: EP4748932A1
The present invention refers to Annexin A8 (AnxA8) inhibitors, or pharmaceutical composition comprising thereof, for use in a method for the treatment and/or prevention of atherosclerosis. Preferably, the method comprises preventing atherosclerotic plaque formation.